10 Jun cell genetics and genetic information – How do the base pairing
Question
cell genetics and genetic information
1. How do the base pairing relationships of DNA bases account for the uniform width of the double helix?
2. Look at Figure 13.13a-c on page 552 on the textbook. What enables the two DNA polymerase III molecules to act on replication as a unit (i.e., simultaneously replicating the leading and lagging strands) even though they are moving toward opposite ends of their respective templates?
3. Histones are known to be largely basic proteins that are predominantly positively charged. How does this explain their tight association with DNA?
4. What are the two major reasons for the multiple initiation sites for eukaryotic replication?
5. The sequences of a particular set of genes are found by in situ hybridization to be heterochromatic in some cells and euchromatic in cells at different stages of development. Briefly explain how this is possible.
6. Despite the numerous checks present in the cell to prevent the placement of the wrong nucleotide in a replicating DNA, a few mistakes can be made. Why is this beneficial in the long term?
7. Figure 11.12 on page 440 in the textbook, shows a transcriptional unit of rRNA with strands of nascent rRNA getting progressively larger as they get closer to the end of the unit, a structure that looks much like an arrowhead. What is the significance of the space between the two arrowheads shown in the picture?
8. Look again at Figure 11.41 on page 466 in the textbook. Given the similarity in the appearances of puromycin and phenylalanyl-tRNA and the fact that puromycin prevents the elongation of a growing polypeptide by entering the A site instead of phenylalanyl-tRNA, as what kind of inhibitor would it be most likely to be classified?
9. Which step in Figure 11.2 (page 431 in the textbook) is reversed by reverse transcriptase?
10. It makes sense that DNA, the stable genetic material of most organisms, should be sequestered in a specific area of the cell to protect it and prevent it from potential damage. On the other hand, the mRNA, the working copy of the genetic code, is relatively short-lived or unstable. Why is the latter advantageous to the cell?
11. Research over the past 50 years has revealed that RNA has catalytic ability, in addition to its role in protein synthesis. What does this discovery suggest in terms of evolution?
12. You are studying protein synthesis in a cell. You have been able to determine very little about the process but have been able to determine that transcription and translation involving the same mRNA cannot occur at the same time. What kind of cell are you studying?
13. The following mRNA was translated from a person with cancer. Find the same base mutation in the following sequence from a cancer cell. (Hint: Find the start and stop codons and translate the mRNA into protein).
C C C A A A U G G A A C C G G G C A U U C A G G U A A C C U A G C C C
Speculate about the consequences of this point mutation in terms of protein function?
14. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acidslong.
TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT
a) Which strand of DNA is transcribed and in which direction? Show your reasoning.
b) Draw the corresponding mRNA sequence and use the genetic code to derive the amino acid sequence of the 5 amino-acid peptide that is produced.
15.
a) Use the genetic code to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments.
b) Label the 5′ and 3′ ends of the DNA and RNA, as well as the amino and carboxyl ends of the peptide.
C DNA double helix
T G A
C A U mRNA transcribed
G C A Appropriate tRNA anticodon
Trp Amino acids incorporated into peptide
From Question 32, p. 348, Griffiths, A., Wessler, S., Lewotin, R., and Carrol, S. 2008. Introduction to Genetic Analysis, 9th ed. W.H. Freeman and Company, New York.
From Question 1, p. 346, Griffiths, A., Wessler, S., Lewotin, R., and Carrol, S. 2008. Introduction to Genetic Analysis, 9th ed. W.H. Freeman and Company, New York.
Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.
About Writedemy
We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.
How It Works
To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Are there Discounts?
All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.