11 Jun Identification of Unknown Bacteria by sequencing rDNA
Question
Rubric # 8
Name ________ ____________________
REPORT 6: Identification of Unknown Bacteria by sequencing rDNA (50 pts).
1. Fill out responses on THIS document.
2. You may reformat to fit in your responses on this document
3. Handwritten report is not acceptable
4. Email submission is not acceptable
_______ 4.0 pts. A. How did you prepare template DNA from your unknown bacteria? B. Name the target DNA (from template DNA) being used for identification? C. Why did we choose this region for identification of your unknown organism? D. What is the size (in bp) of target DNA in Escherichia coli?
A. Heat lysis followed by centrifuge to collect the clear supernatant
B. DNA of 16SrRNA gene region
C. This conserved region helps us to identify the bacteria
D. The size of target DNA in Escherichia coli is 800 bp
__________ 5.0 pts. A. What are conserved regions in rDNA? B. Name the technique used to amplify desired target DNA and explain why we need to amplify target DNA? C. Where, in the target DNA, do the primers bind during PCR? D. How many variable regions are present in rDNA? E. Copy and paste the schematic diagram to show the variable and conserved region alone with primer binding regions
A. The conserved regions in rDNA are the sequence of nucleotides that never changed between rDNA in the organisms.
B.
__________4.0 pts. A. Why did you run agarose gel electrophoresis? B. Did PCR work for both organisms A and B? (Insert image of agarose gel electrophoresis here). C. What is the expected size of your PCR product? D. What was the purpose of NTC?
_________ 4.0 pts. List the reagents used in preparing master mix for PCR and write one sentence about why each one was necessary.
________ 3.0 pts. How do you know that your amplified PCR product is the target region?
________ 6.0 pts. A. What is the principle of Sangers’ sequencing technique? B. Use a labeled diagram (may copy & paste image from internet) to briefly describe the technique [3 point]. C. Write one advantage and one disadvantage of sequencing DNA by this technique. D. Name two other sequencing techniques that can be used to obtain nucleotide sequence of your PCR product.
__________4.0 pts. A. Enter your sequence data here (for A & B). B. Which variable regions are included in your PCR product? C. What is the advantage of sequencing these regions?
A.
Organism A
GTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACGAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTTGGAGGTTGTGCC
Organism B
CAGGATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAACGGACGAGAAGCTTGCTTCTCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGATAACCTACCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCGGATAATATTTTGAACCGCATGGTTCAAAAGTGAAAGACGGTCTTGCTGTCACTTATAGATGGATCCGCGCTGCATTAGCTAGTTGGTAAGGTAACGGCTTACCAAGGCAACGATGCATAGCCGACCTGAGAGGGTGATCGGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACATATGTGTAAGTAACTGTGCACATCTTGACGGTACCNAATCAGAAAGCCACGGCTAACTACGTGTAAAACTCTGTTATTAGGGAAGAACATATGTGTAAGTAACTGTGCACATCTTGACGGTACCNAATCAGAAAGCCACGGCTAACTACGTGTAAAACTCTGTTATTAGGGAAGAACATATGTGTAAGTAACTGTGCACATCTTGACGGTACCNAATCAGAAAGCCACGGCTAACTACGT
B.
_________ 1.0 pt. Will you be able to identify your unknown organism(s) if you used DNA sequence for conserved regions instead of variable regions? (Yes or No)
No, we will now be able to identify our unknown organism(s) if we used DNA sequence for conserved regions instead of variable regions.
________ 3.0 pt. A. Write the acronym for RDP. B. In addition to using DNA sequence data for identification, list two other uses.
A. The acronym for RDP is Ribosomal Database Project
B. Two other uses:
– Clone checking
– Bacterial typing
__________10.0 pt. What organism is the best match based on the nucleotide sequence you searched? Bonus points (5.0) if you can identify both correctly.
Organism A _____________ ______________
(Genus 5.0 pts) (Species 5.0 pts)
Organism B _____________ ______________
(Genus 2.5 pts) (Species 2.5 pts)
_________6.0 pts. Write one advantage and one disadvantage for each of the following identification (finding genus and species names) methods for unknown organisms used this semester:
Advantage Disadvantage
Morphological Unknown I
Biochemical Unknown II
Sequencing Unknown III
Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.
About Writedemy
We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.
How It Works
To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Are there Discounts?
All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.