25 Jun What happens to a duck who flies upside down
Question
The answers don’t have to be long 3 to 4 sentence and if you are using another author’s word please give me a reference if any I will have to turn this into turnitin.com a site for plagiarism. Thanks!
Choose 1 out of the 2 activity to do
·Activity 1 – DNA Decoder (1 activity required)
Discussion Topic
For this activity I am going to give you a strand of RNA to decode to answer a question. Use this RNA to figure out what the strand of DNA was that it was encoded from. Then, use this DNA to answer the question. (you do not need to provide a reference)
1. Question:
What happens to a duck who flies upside down?
2. Strand of RNA:
CUCGAAUACCCAAUUGCAGAGCGGCAGUACAUUCCC
3. Make a complimentary strand of DNA. (please note that the RNA is in capital letters so your DNA should also be in capital letters)
Decode message using the complimentary strand of DNA by going to the DNA-o-gram decoder.
http://www.thinkbiotech.com/DNA-o-gram/
4. While at the website, mutate your DNA and see what happens. Add 1 base, add 3 bases, take away one base, take away 3 bases, make a base-pair substitution. Try these changes both in the middle of your strand and on an end.
5.Respond to this conference by reporting what the decoded message is and explain the importance of even a single mutation in biological systems and provide an example.
Extra Help
In transcription and translation you start with DNA found in the nucleus, then RNA makes a copy of the DNA as instructions to make proteins. In DNA a C always pairs with a G and a T always pairs with an A. So, if I gave you a strand of DNA (AATTCCGG) and asked you to make its compliment you would make (TTAAGGCC).
RNA uses a U instead of a T. So, if I asked you to make a strand of RNA from the DNA (AATTCCGG) the complimentary RNA would be (UUAAGGCC).
This problem asks you to figure out what the complimentary DNA strand was that the RNA was coded from. So, you start with the RNA, make a complimentary DNA and then plug that code into the decoder to get the answer to the problem.
Here is a problem and its answer that you can use to make sure you understand how to solve it.
Question – What is your instructor’s first name?
RNA provided – UUCCUACCUGACAGU
Complimentary DNA which you figure out – AAGGATGGACTG TCA
Plug the complimentary strand of DNA into the decoder and you should get “Cindy” as your answer.
·.umuc.edu/d2l/le/content/124844/viewContent/5453791/View” title=”‘Activity 2 – Protein Synthesis (1 activity required)’ – Discussion Topic”>Activity 2 – Protein Synthesis (1 activity required)
Please try the activity below. Click on “DNA Replication” on the left to match up DNA base pairs and then click on “Protein Synthesis” on the right to practice the steps needed to make a protein from a DNA template using mRNA and tRNA.
Please write about what you learned. You do not need to include a reference.
DNA Workshop
http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html
Alternate activity if you have technical difficulties with the first website.
http://learn.genetics.utah.edu/content/molecules/transcribe/
Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.
About Writedemy
We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.
How It Works
To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Are there Discounts?
All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.