Chat with us, powered by LiveChat Chapter 2 1. For our purposes, we will define organic molecule | Writedemy

Chapter 2 1. For our purposes, we will define organic molecule

Chapter 2 1. For our purposes, we will define organic molecule

Question

Chapter 2

1. For our purposes, we will define organic molecules as those molecules that are complex and contain C and H. (Think of C and H sugar as organic). Inorganic molecules are relatively simple in structure and can contain C or H, but not C and H in the same molecule. Classify the following molecules as organic or inorganic:
a) H2O (water)
b) O2 (oxygen)
c) C18H29SO3 (styrofoam)
d) FeO (iron oxide)
e) C2H6O (ethanol)

2. Name 3 additional inorganic compounds.

a.

b.

c.

3. What atoms must be present in a molecule for it to be considered organic?

1. What characteristics of carbon make it ideal for the formation of organic compounds?

2. What are functional groups?

3. Differentiate between a monomer and a polymer.

4. How are polymers formed?

4. What characterizes the carbohydrates?

1. Differentiate between mono-, di-, and polysaccharides, and give examples of each.

2. What are some of the functions of polysaccharides in the cell?

5. Draw simple structural molecules of triglycerides and phospholipids to compare their similarities and differences.

1. How are saturated and unsaturated fatty acids different?

2. What characteristic of phospholipids makes them essential components of cell membranes?

3. Why is the hydrophilic end of phospholipids attracted to water?

6. Describe or draw the basic structure of an amino acid.

1. What makes the amino acids distinctive, and how many of them are there?

2. What is a peptide bond?

3. Differentiate between a peptide, a polypeptide, and a protein.

4. Explain what causes the various levels of structure of a protein molecule.

5. What functions do proteins perform in a cell?

7. Describe and/or draw a nucleotide and a polynucleotide, and compare and contrast the general structure of DNA and RNA.

Chapter 3

_________________________________________________________
Microbiology

Chapter 3-Cell Structure and Function

Why is it important to study cells?

Processes of Life

Describe four major processes of living cells.

1.

2.

3.

4.

Prokaryotic and Eukaryotic Cells: An Overview

Compare and contrast prokaryotic and eukaryotic cells by providing at least 3 similarities and 3 differences.

Similarities

Differences

External Structures of Bacterial Cells

Glycocalyces

Describe the composition, function and relevance to human health of glycocalyces.

Distinguish capsules from slime layers.

Flagella

Discuss the structure and function of bacterial flagella.

Fimriae and Pili

Compare and contrast the structures and functions of fimbriae, pili and flagella.

Structure

Function

Fimbriae

Pili

Flagella

Similarities

Differences

Bacterial Cell Walls

Describe common shapes and arrangements of bacterial cells.

Describe the sugar and peptide portions of peptidoglycan.

Compare and contrast the cell walls of Gram-positive and Gram-negative bacteria in terms of structure and Gram staining

Highlight green box

Biofilms: Slime Matters

What are biofilms and how do they impact human health?

Gram-Positive Bacteria Cell Walls

Compare and contrast the cell walls of acid-fast bacteria with typical Gram-positive cell walls.

Gram-Negative Bacteria Cell Walls

Describe the clinical implications of the structure of the Gram-negative cell wall.

CRITICAL THINKING

After a man infected with the bacterium Escherichia coli was treated with the correct antibiotic for this pathogen, the bacterium was no longer found in the man’s blood, but his symptoms of fever and inflammation worsened. What caused the man’s response to the treatment? Why was his condition worsened by the treatment?

Bacterial Cytoplasmic Membranes

Structure

Diagram a phospholipid bilayer, and explain its significance in reference to a cytoplasmic membrane.

Explain the fluid mosaic model of membrane structure.

Function

Describe the functions of a cytoplasmic membrane as they relate to permeability.

Compare and contrast the passive and active processes by which materials cross a cytoplasmic membrane.

Define osmosis, and distinguish among isotonic, hypertonic, and hypotonic solutions.

CRITICAL THINKING

Osmotic pressure

Solutions hypertonic to bacteria and fungi are used for food preservation. For instance, jams and jellies are hypertonic with sugar, and pickles are hypertonic with salt. How do hypertonic solutions kill bacteria and some fungi that would otherwise spoil these foods?

Cytoplasm of Bacteria

Describe bacterial cytoplasm and its basic contents.

What is a nucleoid?

How is a bacterial chromosome different than a human one?

Endospores

Briefly describe the structure and function of endospores.

What are the two main genera of bacteria that produce endospores?

Why are endospores clinically significant?

CRITICAL THINKING

Following the bioterrorist anthrax attacks in the fall of 2001, a news commentator suggested that people steam their mail for 30 seconds before opening it. Would the technique protect people from anthrax infections? Why or Why not?

Nonmembranous Organelles

Describe the structure and function of ribosomes.

Why are ribosomes clinically significant?

Structure of Eukaryotic Cells vs. Prokaryotic Cells

Describe 3 similarities between eukaryotic and prokaryotic cells.

1.

2.

3.

Describe 3 differences between eukaryotic and prokaryotic cells.

1.

2.

3.

Endosymbiotic Theory

Describe the endosymbiotic theory of the origin of mitochondria and eukaryotic cells.

List evidence that supports the endosymbiotic theory.

From Chapter 11

Morphology of Prokaryotic Cells

Draw the 3 major bacterial shapes.

1. coccus=

2. bacillus=

3. spirals=

What is a vibrio?

What is a coccobacillus?

What is pleomorphism?

What is the difference between the use of the term bacillus and the name Bacillus? Staphylococcus and staphylococcus?

What do the terms strepto- and staphylo- mean?

Reproduction of Prokaryotic Cells

Describe binary fission.

How is this different from mitosis?

Microbiology

Chapter 6-Microbial Nutrition and Growth

1. Describe the roles of carbon, hydrogen, oxygen, nitrogen, trace elements, and vitamins in microbial growth and reproduction.

2. Compare the four basic categories of organisms based on their carbon and energy sources.

3. Distinguish among anaerobes, aerobes, aerotolerant anaerobes, facultative anaerobes and microaerophiles.

4. Explain how oxygen can be fatal to organisms by discussing singlet oxygen, superoxide radical, peroxide anion, and hydroxyl radical.

5. Explain how organisms protect themselves from toxic forms of oxygen.

6. Define nitrogen fixation, and explain its importance.

7. Explain how extremes of temperature, pH, and osmotic and hydrostatic pressure limit microbial growth.

8. Describe how quorum sensing can lead to formation of a biofilm.

9. Describe methods for collecting clinical specimens from the skin and from the respiratory, reproductive, and urinary tracts.

10. Describe the two most common methods by which microorganisms can be isolated for culture.

11. Describe six types of general culture media available for bacterial culture.

12. Discuss the use of special culture methods, including animal and cell culture, low-oxygen culture, and enrichment culture.

13. Contrast refrigeration, deep freezing, and lyophilization as methods for preserving cultures of microbes.

14. Define logarithmic growth.

15. Explain what is meant by the generation time of bacteria.

16. Draw and label a bacterial growth curve.

17. Describe what occurs at each phase of a population’s growth.

18. Compare and contrast direct and indirect methods of measuring bacterial reproduction.

Chapter 7

_____Microbiology

Chapter 7-Microbial Genetics

The Structure and Replication of Genomes

Define genome.

Define gene.

What is the relationship between genes and genome?

What does DNA stand for?

The Structure of Nucleic Acids

Nucleic acids, like DNA and RNA, are polymers composed of monomer subunits(building blocks).

The monomers(building block) of DNA are deoxyribose nucleotides. Nucleotides are composed of 3 different parts: (refer to pg. 202, Fig. 7.4a)

1. Nitrogenous base-shown in teal as a guanine base (note the many nitrogens)

2. Sugar molecule-DNA has deoxyribose-shown in purple

3. Phosphate-shown as a PO4 group that is repeated 3 times, however note in Fig. 7.4b that 2 of the phosphates are cut to release their energy when the monomers are used in an anabolic reaction.

There are 4 types of DNA nucleotides that bind in a specific complementary fashion (called base pairing).

What are the 4 types of DNA nucleotides?

1.

2.

3.

4.

Which bases bind together?

There are 4 types of RNA nucleotides that bind in a specific complementary fashion.

What are the 4 types of RNA nucleotides?

1.

2.

3.

4.

Which bases bind together?

What is the difference between RNA and DNA?

You will see some similar questions in the genetics lab handout but a little repetition can be helpful.

Refer to Fig. 7.1 (d) and note the basic structure of DNA and how the individual nucleotides are put together. It reminds me of a spiral staircase with the sides of the staircase as the “backbone of DNA” which is alternating units of phosphate and deoxyribose(sugar) covalently bonded together. The stair steps of the staircase are the nitrogenous bases which are complementary bound to one another through weak hydrogen bonds.

Note: do not worry about the 5’ and 3’ terminology.

This refers to a specific carbon atom, but we will not have to get that detailed for our purposes.

Briefly describe the 2 ways that DNA structure helps explain its ability to act as genetic material.

1.

2.

CRITICAL THINKING

The chromosome of Mycobacterium tuberculosis is 4,411,529 bp long. A scientist who isolates and counts the number of nucleotides in it DNA molecule discovers that there are 2,893,963 molecules of guanine. How many molecules of the other three nucleotides are in the original DNA?

How many base pairs are found in Escherichia coli? How many base pairs are found in human?

1. E. coli base pairs=

2. Human base pairs=

How long in meters is the entire human genome?

When human DNA is packed into a nucleus it’s like packing 45 miles of thread in to a ___________ _____________.

The Structure of Prokaryotic Genomes

A typical prokaryotic chromosome is one single circle of DNA found in what region of the cell?

Briefly describe the structure of a plasmid.

Are the genes carried on plasmids essential for normal growth?

Explain the types of genes and specific example of Resistance plasmids:

Types of genes:

Specific example:

Explain the types of genes and specific example of Virulence plasmids:

Types of genes:

Specific example:

The Structure of Eukaryotic Genomes

Compare and contrast prokaryotic and eukaryotic chromosomes by stating 2 similarities and 2 differences between them.

DNA Replication: Preserving the Code and Passing it On

Explain what is meant by the term “semiconservative replication”. Are the new strands identical to the original segment of DNA?

Watch the ANIMATION: DNA Replication: Overview and explain the process in your own words.

The enzymes and processes that you will be responsible for are 1)helicase and 2)DNA polymerase III.

You will not need to worry about the other enzymes and terms like lagging and leading strand, etc.

Using the terms helicase and DNA polymerase, explain how DNA replication takes place:

Replicate the following segment of DNA by writing the complementary sequence below the parent strand. NOTE: the strands have already been separated by helicase.

TTCCAGTCATGCAAGGCTGTAACTGA

CRITICAL THINKING:

Hydrogen bonds between complementary nucleotides are crucial to the structure of dsDNA because they hold the two strands together. Why couldn’t the two strands be effectively linked by covalent bonds?

Gene Function

The Relationship Between Genotype and Phenotype

Define genotype.

Define phenotype.

Explain the relationship between genotype and phenotype.

The Transfer of Genetic Information

State the central dogma of genetics (refer to Fig. 7.8).

Define transcription.

Define translation.

How is the language of the gene expressed? We need to get from DNA to a protein(since proteins are the true workers of the cell). How do we do it?

The master code of ______ is first used to synthesize a copy in the form of an ______ molecule via a process called ___________________, and the information contained in the RNA is then used to produce ___________in a process known as ______________________.

Watch the animations and In your words summarize the events in transcription using the following words. 1) DNA, 2)promoter region 3)RNA polymerase, 4)RNA nucleotides, 5)RNA transcript, 6)termination site

Where does transcription begin?

At the promotersite which acts like a green light to transcribe a gene

Where does transcription end?

At the terminator site which acts like a stop light to transcribe a gene.

There are four main types of RNA but we’ll only cover 3 of them which are:

1. Messenger RNA (mRNA)

2. ribosomal RNA (rRNA)

3. transfer RNA (tRNA)

Fill in the blank with the type of RNA that matches the definition:

_________________: carries (transfers) the correct amino acid to the ribosome to translate a protein from mRNA.

_________________: contains the message from DNA that codes for a specific protein (that protein will have a specific job in the cell)

_________________: makes up the ribosome

CRITICAL THINKING

On average, RNA polymerase makes one error for every 10,000 nucleotides it incorporates in RNA. By contrast, only one base-pair error remains for every 10 billion base pairs during DNA replication. Explain why the accuracy of RNA transcription is not as critical as the accuracy of DNA replication.

Read the Emerging Disease Case Study: Vibrio vulnificusInfection.

Did you know that a beach could be so dangerous?

Translation

Explain the process of translation.

What can ribosomes be thought of as?

The Genetic Code

What is a codon?

How many codons exist?

What is a codon made of?

Describe the genetic code in general and identify the relationship between codons and amino acids.

What is an anticodon?

Does each codon have a unique amino acid or is there some redundancy?

CRITICAL THINKING

We have seen that wobble makes the genetic code redundant in the third position of the codon for C and U. After reexamining the genetic code in Fig. 7.12, state what other nucleotides in the third position appear to accommodate anticodon wobbling.

Describe the synthesis of polypeptides, identifying the roles of the 3 types of RNA.

What are the main “players” in translation? Refer to Fig. 7.17

1. Ribosome (large and small subunit with rRNA thread)

2. mRNA transcript

3. tRNAs with a SPECIFIC amino acid attached

When the mRNA transcript makes it to the ribosome it is threaded through the ribosome just like thread through the eye of a needle.

What is the ribosome looking for on the mRNA transcript before it can start translating the nucleic acid code into amino acids(protein)?

Hint: the green light to start translation called the start codon which is ___________ (refer to Fig. 7.12)

The master genetic code is the actual code that us humans can use to decode nucleic acid language into protein language and vice versa.

Note the different “languages” involved:

1) DNA language written in triplets

2) mRNA written in codons

3) tRNA written in anticodons

4) protein language written in amino acids

What is the actual link between nucleic acid language and protein language?

Hint: what is the molecule called that has an RNA anticodon on one end and an amino acid on the other end? Refer to Fig. 7.14

What are the functions of start and stop codons? Give examples of them.

Observe the strand of nucleotides at right. Is this DNA or RNA? How do you know?

GTCCTACGGCATCGGTACTAAA

Use the genetic code in Fig. 7.12 for the following question. Write the mRNA strand out in the blank. Write the sequence of amino acids coded for by the mRNA strand.

GTCCTACGGCATCGGTACTAAA

Transcription

(mRNA)__________________________________

Translation

(amino acid)_______________________________

Briefly explain the process of translation using the following terms:

1)mRNA, 2)ribosome, 3)tRNA, 4)amino acids, 5)codon, 6)anticodon

DNA language consists of 3 consecutive bases called triplets.

Each triplet of DNA can give rise to 1 _________ acid.

If a protein is 3300 amino acids long, how many nucleotide pairs long is the gene sequence that codes for it?

Regulation of Genetic Expression (pg. 213)

Are genes on all the time? Why or why not?

Genetic regulation is quite complex and we will not cover it in depth. I will be happy that you know that genes are turned on and off as needed(just like you turn lights on and off as needed), although some genes are needed on all the time(just like the refrigerator is on all the time.)

What is iRNA?

Read the Highlight on pg.217, Flipping the switch: RNA interference. It will come handy when we stream Dr. Baltimore’s lecture on viruses and what his lab is doing to tackle AIDS.

MUTATIONS OF GENES

Define mutation.

List the 3 types of effects of all mutations and their relative frequencies.

Type of Effect from mutation

Frequency

1. Harmful

1. most common

2. Neutral

2. sometimes

3. Beneficial

3. least common but does occur

Define point mutation.

Point mutations include:

1. substitutions of 1 or more nucleotides

2. insertions of 1 or more nucleotides

3. deletions of 1 or more nucleotides

If you start with the following DNA code and separate it into 3 letter words

Original DNA =THECATATEELK

Original DNA =THE CAT ATE ELK

If the DNA is mutated and now reads what type of change has happened?

Mutated DNA= THE RAT ATE ELK

Change=______________________

If the DNA is mutated and now reads what type of change has happened?

Mutated DNA= TRH ECA TAT EELK

Change=______________________

If the DNA is mutated and now reads what type of change has happened?

Mutated DNA= TEC ATA TEE LK

Change=______________________

Define frameshift mutation and explain its possible serious consequences.

What is a silent mutation and give an example?

What is a missense mutation and give an example?

What is a nonsense mutation and give an example?

Briefly explain how a mutation in DNA can change a protein’s structure and/or function.

Does our genetic code, genotype, ever change?

Yes, mutations naturally occur since our enzymes are not perfect and this slight spontaneous genetic change is the driving force of evolution but if there are too many of the wrong mutation in a single human cell the result may be cancer.

Define mutagen.

Explain the effects of the following mutagens.

Mutagen

Effects

1.Physical=Ionizing radiation (like X rays)

2. Physical =Non-ionizing radiation(like UV rays in sunlight)

3. Chemical =Nucleotide analogs(like anti-viral or anti-cancer drugs)

4. Chemical=Frameshift mutagens(like acridine)

Can mutations be fixed or repaired by cells?

Sometimes

Identifying Mutants, Mutagens and Carcinogens

Define wild type (wild strain) and mutant strain.

Wild type strain=

Mutant strain=

.

The Ames Test

Briefly describe the purpose of the Ames test?

The Ames test exposes bacteria to potential mutagens and if a specific mutagen can cause a mutation in bacteria it is further tested in animal cells to see if it’s indeed a carcinogen. Using bacteria allows researchers to screen many more potential mutagens much faster.

Genetic Recombination and Transfer

Define recombination.

Contrast vertical gene transfer with horizontal gene transfer.

Genetic Exchange Mode

Factors Involved

Examples of genes transferred

1. Conjugation

A plasmid is transferred between 2 live cells using a pilus

2. Transformation

A fragment of DNA from a lysed cell is “absorbed” by a live cell

3. Transduction

A bacteriophage carries DNA from cell to cell

4. Transposition

A gene “jumps” from place to place on a plasmid or chromosome

Define bacteriophage (also called a phage).

Read the Clinical Application regarding Deadly Horizontal Gene Transfer on pg. 230. Answer the questions below:

Define nosocomial infection.

2. What is the likely source of infection?

3. List 3 ways in which Enterococcus faecium might have acquired genes for drug resistance.

1.

2.

3.

4. How could hospital personnel prevent the spread of resistant E. faeciumthroughout the hospital?

Fill in the following table:

Process

Purpose

Beginning point

Ending point

Replication

origin

End of molecule

Transcription

promoter

Translation

Synthesis of polypeptides (proteins)

Explain the central dogma of genetics.

Explain why DNA polymerase is so named.

Vancomycin has been a powerful antibiotic against Gram-positive bacterial infections since the 1950s. It has been especially valuable against those bacteria that are resistant to other commonly used antibiotics. For some bacterial strains, such as certain strains of Staphylococcus aureus that are resistant to drugs like penicillin or methicillin, vancomycin is the only drug that is still effective. The antibiotic works by disrupting assembly of the bacterial cell wall.

Since the 1980s, however, many strains of bacteria have acquired resistance to vancomycin as well. In these bacteria there is a mutation that changes the composition of the cell wall. Vancomycin cannot attache to the modified cell wall inthe mutant strain. Many patients infected with vancomycin-resistant(VR) bacteria are essentially untreatable, because these bacteria are often resistant to other antibiotics as well.

1. What exactly is a mutation.

2. How and why do mutations occur?

Chapter 9

Microbiology

Chapter 9-Controlling Microbial Growth in the Environment

In order to use correct and precise terminology, define the follow terms from table 9.1:

Term

Definition

Example

Sterilization

Aseptic

Disinfection

(Disinfectant)

Antisepsis (Antiseptic)

Degerming

Sanitization

Pasteurization

-Stasis/-static

-cide/cidal

How is sterilization different from disinfection?

How is disinfection different from antisepsis?

Give an example of degerming.

Give an example of sanitization.

What types of products use pasteurization?

CRITICAL THINKING: A student inoculates Escherichia coli into two tubes containing the same sterile liquid medium, except the first tube also contains a drop of a chemical with an antimicrobial effect. After 24 hours of incubation, the first tube remains clear, whereas the second tube has become cloudy with bacteria. Design an experiment to determine whether this amount of the antimicrobial chemical is bacteriostatics or bactericidal against E. coli.

ANSWER=

Refer to Figure 9.1. How many minutes are required for sterilization if a microbicidal agent killed 90% microbes per minute?

Action of Antimicrobial Agents

What are the 5 major targets of antimicrobial agents?

1.

2. Cell membranes

3.

4. Damage to Nucleic Acids

5. Inhibition of metabolism

What happens if a cell’s membrane is damaged?

What happens if the envelope of a virus is damaged?

What happens if a cell’s proteins are damaged?

CRITICAL THINKING: Would you expect Gram-negative or Gram-positive bacteria to be more susceptible to antimicrobial chemicals that act against cell walls? Explain your answer, which you should base solely upon the nature of the cells’ walls.

ANSWER=

The Selection of Microbial Control Methods

Ideally

Ideally, agents used for the control of microbes should be __________________, fast-acting, and _________________ during storage. Further a perfect agent would control the growth and reproduction of every type of microbe while being harmless to _____________________________________. Does such an agent exist? ________________________

Factors Affecting the Efficacy of Antimicrobial Methods

List and briefly describe the 3 factors to consider in selecting a microbial control method.

1.

2.

3.

Relative Susceptibility of Microorganisms

Fill in the following chart which lists microbes and their relative susceptibilities to microbial control.

Most resistant

Prions

________________

Mycobacteria

________________

Active stage protozoa

____________________

Fungi

Nonenveloped viruses

____________________

Enveloped viruses

Most susceptible (Least resistant)

Figure 9.2-Why are nonenveloped viruses general more resistant than enveloped viruses?

We’ve learned in class that bacterial endospores like Bacillus anthracis or Clostridium difficile, C. botulinum, C. tetani or C. perfringens are hard to disinfect. What kinds of conditions can they withstand for how much time?

Why are bacteria in the genus, Mycobacterium (like M. tuberculosis) so hard to kill?

Environmental conditions that can affect microbial death rates and the efficacy (effectiveness) of antimicrobial methods include:

1. temperature

2. pH

3. organic materials such as fat, feces, vomit, blood and biofilms can interfere with the penetration of heat, chemicals and some forms of radiation and therefore objects need to be cleaned well before sterilization and disinfection can be done.

Methods for Evaluating Disinfectants and Antiseptics

Is it important to know how well a particular disinfectant works against a certain microbe? Why or why not?

Read Emerging Diseases Case Study about Acantamoeba keratitis on pp. 263

There are two main ways to control microbes:

1. Physical methods

2. Chemical methods

It’s imperative to know if an object needs to be sterile or disinfected.

Would you like sterilized or disinfected dental instruments used in your mouth during your dental cleaning?

Which do you think is more expensive?

Sterilization or disinfection?

Another important factor to consider in selecting a microbial control strategy is the object you are sterilizing.

Could you put a plastic petri dish in the autoclave and still use it? Why or why not?

Complete the chart regarding Physical Methods of Microbial Control

Physical Methods of Microbial Control

Table 9.4 (pg. 271)

Method

Conditions

Representative use(s)

1. Boiling

(Moist heat)

2. Autoclaving (pressure cooking) (moist heat)

3. Pasteurization (moist heat)

4. ultra high temp (UHT) sterilization

(moist heat)

5. hot air (dry heat)

6. incineration (dry heat)

7. refrigeration

8. Freezing

9. Dessication (drying)

10. Lyophilization (freeze-drying)

11. filtration

12. osmotic pressure

13. ionizing radiation

14. nonionizing radiation

Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.

Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.

Do you need an answer to this or any other questions?

About Writedemy

We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.

How It Works

To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.

Are there Discounts?

All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.

Hire a tutor today CLICK HERE to make your first order