BIOL 103 – According to evolutionary theory, you are related to a bacterium

14 Jun BIOL 103 – According to evolutionary theory, you are related to a bacterium

Question
Question 1 (2 points)
Which statement about evolution is FALSE?

Question 1 options:
According to evolutionary theory, you are related to a bacterium, to a yeast cell, to a snake, and to a whale. In fact, you are related to every species now alive on Earth, and to fossil species like dinosaurs as well.

Natural selection acts on genetic differences within a population to cause evolution. Individuals do not evolve.

Natural selection is about slow but steady progress. Through it, populations constantly get better-adapted. When this process is completed for all populations, evolution will come to a stop.

Evolution occurs constantly, without end; there is no endpoint in evolution.

Question 2 (2 points)
Negatively charged particles are found where in an atom?

Question 2 options:
In the nucleus

In a single layer outside the nucleus

In multiple layers outside the nucleus

Both inside and outside the nucleus

Question 3 (2 points)
Which characteristic of water protects fish when a lake freezes?

Question 3 options:
cohesion

water is less dense as a solid
water as a solvent

all of the above

Question 4 (2 points)
You have a solution that has a pH of 8 and need it to be pH 5. What do you do?

Question 4 options:
Add water

Add a base

Add an acid

Add a buffer

Question 5 (2 points)
What characteristic of carbon makes it a good backbone for creating diverse and durable molecules?

Question 5 options:
Carbon is a large atom.

Carbon forms four covalent bonds.

Carbon forms hydrogen bonds.

All of the above

Question 6 (2 points)
Which of the following structures can be found together in eukaryotic cells?

Question 6 options:
cytoplasm and ribosomes

cytoplasm and plasma membrane

DNA and ribosomes

ribosomes and endoplasmic reticulum

Question 7 (2 points)
Which of the following reactions or pathways is catabolic?

Question 7 options:
Converting glucose to carbon dioxide and water (cellular respiration).

Making starch from many glucose molecules.

Photosynthesis: which builds glucose from carbon dioxide using energy from light.

Making ATP from ADP and Phosphate.

Question 8 (2 points)
In a metabolic pathway, a typical control mechanism is to have: ________

Question 8 options:
the final product inhibit the enzyme responsible for its own production.

the final product inhibit an early step.

a reactant inhibit a late step.

a lack of reactant stimulate the pathway.

Question 9 (2 points)
Mitosis results in ______ cells and meiosis results in _______ cells.

Question 9 options:
haploid, diploid

diploid, haploid

diploid, diploid

haploid, haploid

Question 10 (2 points)
In beans yellow (Y) is dominant to green (y) and smooth (S) is dominant to wrinkled (s). What are the possible genotypes for the offspring of the following cross: YySS and YYSs.

Question 10 options:
YYSS, YYss, yySS, yyss

YS, yS, YS, yS

Yy, SS, YY, Ss

YYSS, YySS, YYSs, YySs

Question 11 (2 points)
Red rose color is incompletely dominant over white rose color. If a red rose is crossed with a pink rose, what percentage of the offspring will be pink?

Question 11 options:
100

75

50

25

Question 12 (2 points)
One of the products of cellular respiration is ________.

Question 12 options:
water

sucrose

cellulose

oxygen

Question 13 (2 points)
An ecologist is studying all the animals, plants, fungi and bacteria, as well as the interaction among them, in a forest? He is studying the _________ in the forest.

Question 13 options:
niche

biome

community

population

Question 14 (2 points)
The temperature optimum for an enzyme is 37C. What will most likely happen if you increase the temperature from 37C to 50C?

Question 14 options:
The enzyme activity will not be affected

The enzyme activity will increase

The enzyme activity will decrease

The pH will increase

Question 15 (2 points)
When celery is placed in a glass of pure water the solution inside its cells is _____ compared to the water.

Question 15 options:
selectively permeable

isotonic

hypertonic

hypotonic

Question 16 (2 points)
An ecosystem can be characterized as:

Question 16 options:
populations + community.

all species, population, and community interactions for organisms in a given area.

the abiotic components of the environment.

all of the biological interactions, plus interactions with the abiotic environment, in a given area.

Question 17 (2 points)
In October of 2003, a raging wildfire swept through the mountain ecosystems in Southern California, burning everything in its path to the ground and driving away all of the animals. In order for the mountain ecosystem to re-establish itself, which member of the food web has to return first?

Question 17 options:
deer

coyotes

snake

grasses

Question 18 (2 points)
Carbohydrates are not

Question 18 options:
stored potential energy

made mostly of nitrogen and carbon.

broken down by cellular respiration.

made by producers.

Question 19 (2 points)
A primary consumer would eat:

Question 19 options:
secondary consumers

plants.

Bacteria.

rabbits.

Question 20 (2 points)
Diffusion is

Question 20 options:
One type of active transport
The movement of water across the cell membrane
The movement of molecules from an area of high concentration to an area of low concentration
The movement of molecules from an area of high concentration to an area of low concentration

Question 21 (2 points)
Any individual organism has the potential to adapt to its environment, if it is given enough time and possesses a mechanism to generate variation.

Question 21 options:
True
False

Question 22 (2 points)
Humans are more likely to be infected by viruses after the viruses had a chance to multiply outside the body on surfaces touched by infected people.

Question 22 options:
True
False

Question 23 (2 points)
Once an adaptation appears, it remains in all the descendants unless the species becomes extinct

Question 23 options:
True
False

Question 24 (2 points)
During a time when resources are abundant, one would not expect much evolutionary change to happen.

Question 24 options:
True
False

Question 25 (2 points)
When a founder population has a small gene pool, evolutionary change is more likely to be rapid than if the founder population has a large gene pool.

Question 25 options:
True
False

Question 26 (2 points)
When speciation occurs, the result is a dramatic change in the new species.

Question 26 options:
True
False

Question 27 (2 points)
When two groups are reproductively isolated, it can be predicted that speciation will soon follow.

Question 27 options:
True
False

Question 28 (2 points)
Fossil evidence suggests that human ancestors arose one time in Africa.

Question 28 options:
True
False

Question 29 (2 points)
Levels of ultraviolet light influences vitamin D production is humans.

Question 29 options:
True
False

Question 30 (2 points)
Mitochondria and chloroplasts of eukaryotic cells are very similar to prokaryotes

Question 30 options:
True
False

Question 31 (2 points)
Organisms that live in habitats with high levels of competition are more likely to produce defensive chemicals than those that live with little competition.

Question 31 options:
True
False

Question 32 (2 points)
The human population may continue to increase even though it surpasses carrying capacity.

Question 32 options:
True
False

Question 33 (2 points)
Scientific studies suggest that the many organs susceptible to cancer as a result of smoking, the kidneys and bladder are exceptions, showing no differences in cancer rates as compared to non-smokers.

Question 33 options:
True
False

Question 34 (2 points)
A woman’s ovum will complete Meiosis II only, if fertilization has occurred.

Question 34 options:
True
False

Question 35 (2 points)
One human disease is caused by a change in the DNA from GAA to GUA. This change is an example of:

Question 35 options:
crossing over

a mutation

a meiosis error

a mitosis error

Question 36 (2 points)
The main function of a ribosome is to ____________________.

Question 36 options:
extract energy from glucose

synthesize glucose

store food in the form of fat

synthesize proteins

Question 37 (2 points)
The effectiveness of a medication containing growth hormone is tested on a group of young male rabbits 3 weeks of age. The best control group would be:

Question 37 options:
any group of rabbits

a group of young male rabbits 3 weeks of age, not given the medication

a group of young female rabbits 3 weeks of age, not given the medication

no control is required; just measure whether the rabbits grew

Question 38 (2 points)
The number of _______________ in the outer shell of an atom determines the type of chemical bonds an atom can make.

Question 38 options:
electrons

protons

ions

neutrons

Question 39 (2 points)
You find a cell of a type you have never seen before. The cell has both a nucleus and a cell wall. Therefore, you conclude, it must be a _______________ cell.

Question 39 options:
liver

animal

bacterial

plant

Question 40 (2 points)
The gene pool of a population may change due to:

Question 40 options:
migration

genetic drift

natural selection and mutation

all of the above

Question 41 (5 points)
You have read that inorganic fertilizers contribute to water pollution and would like to make a switch from inorganic fertilizers to organic compost in your vegetable garden. A friend graciously gives you a truck load of his compost. As a good researcher and critical thinker you are not convinced that organic compost will yield the same results as the inorganic fertilizer you have used for years with good results. To draw your own conclusion based on scientific evidence you decide to conduct an experiment in your garden. State a good hypothesis, design an experiment (include test subjects, sample size, control(s), dependent and independent variables, type of data collected) and hypothetical results/conclusion. Does your conclusion support the hypothesis?

Question 41 options:

Question 42 (5 points)
You are working on a molecular biology project and you have been asked by your boss to determine the protein sequence that you will get from the following DNA sequence.
Part A) What is the complementary sequence for the following DNA sequence?

5’ – CGACCATGCCAGTATTCCTCAGGCACGAGTCAGGGCCCTAACCC– 3’

Answer_____________________________________________________________

Part B) Transcribe the sequence above.

Answer______________________________________________________________

Part C) Translate the sequence you have obtained in Part B.

Answer__________________________________________________________

Question 42 options:

Question 43 (5 points)
There are 200 students in your science class and you decide to do a research project focused on the distribution of alleles for brown versus blue eye color. You examine everyone and find out that 128 students have brown eyes and 72 have blue eyes. You know the brown eye allele is dominant over the blue eye allele. Using the Hardy Weinberg law calculate:
the allelic frequency of the recessive allele
the allelic frequency of the dominant allele
the expected number of homozygous dominants in the population
the expected number of heterozygotes in the population
the expected number of homozygous recessives in the population
Question 43 options:

Question 44 (5 points)
You scoop up a water sample from a local pond nearby, because you are curious about the possible microbes that might live there. After looking at several slides that held drops of the sample, you noticed two different kinds of cells: One kind was very small and had no separate internal structures; the other kind was much larger, and it contained several kinds of internal structures that were physically different from each other. Please name each cell and briefly describe their overall similarities and differences.

Question 44 options: