08 Jun BIOL302 final exam
Question
Student’s Name
Final exam BIOL 302 Bacteria, Viruses, and Health Summer 2016
Part A Multiple Choice: (1 point each)
1. In the lab you use the gram staining procedure, a differential staining technique, as a first step in identifying the type of bacteria on a slide. After you carefully perform the staining procedure, you look at the cells under the microscope and see purple rod shaped cells. This result indicates that
a. the cells have a thick peptidoglycan layer as part of the physical structure of the cell wall and are gram-positive bacilli.
b. the cells have a thin peptidoglycan layer as part of the physical structure of the cell wall and are gram-positive bacilli.
c. the cells have a thin peptidoglycan layer as part of the physical structure of the cell wall and are gram-negative cocci.
d. the cells have a thin peptidoglycan layer as part of the physical structure of the cell wall and are gram-negative bacilli.
e. the cells have a thick peptidoglycan layer as part of the physical structure of the cell wall and are gram-negative bacilli.
Answer a. the cells have a thick peptidoglycan layer as part of the physical structure of the cell wall and are gram-positive bacilli.
2. Which of the following infectious diseases has (or have) been eradicated in the world?
a. polio
b. measles
c. smallpox
d. whooping cough
e. all of the above
Answer c. smallpox
3. Which of the followings is a characteristic of prions that is unique from other known pathogenic microbes?
a. They lack the characteristics of a classic cell.
b. They can be transmitted from animals to man.
c. They cause permanent damage to the host.
d. They are made entirely of protein.
Answer b. They can be transmitted from animals to man.
4. The first microorganism demonstrated to satisfy Koch’s postulates (in the late 19th century) was
a. Mycobacterium tuberculosis
b. Bacillus anthracis
c. Mycobacterium leprae
d. Vibrio cholera
Answer a. Mycobacterium tuberculosis
5. Which of the following is a characteristic of the adaptive immune response and not of the innate immune response?
a. Physical and chemical barriers
b. Clonal expansions of activated B cells
c. Inflammatory mediators
d. Phagocytosis
Answer b. Clonal expansions of activated B cells
6. What does each codon in messenger RNA (mRNA) specify?
a. a nucleotide
b. an enzyme
c. an amino acid
d. a promoter
Answer c. an amino acid
7. Antigens are
a. specific.
b. proteins or polysaccharides (complex sugars).
c. recognized as foreign by the body’s immune system.
d. all of the above.
Answer d
8. Oncogenes are genes that
a. the virus utilizes to replicate itself.
b. transform normal cells to cancer cells.
c. promote genetic recombination in bacteria.
d. influence ongoing protein production.
Answer b. transform normal cells to cancer cells.
9. Genes A, B, and C are three structural genes of an operon and fall in that order within the operon. A mutation occurs in Gene A that halts transcription early in the gene. What effect will this have on the levels of proteins produced by Genes A, B, and C?
a. No proteins coded by genes A, B, and C will be produced.
b. Proteins coded by genes B and C, but not gene A, will be produced
c. Proteins coded by genes A, B, and C will be produced.
d. Only proteins coded by gene A will be produced.
Answer a. No proteins coded by genes A, B, and C will be produced.
10. Plasmids
a. replicate with the bacterial chromosome.
b. may contain antibiotic resistance genes.
c. are as large as the bacterial chromosome.
d. contain genes essential for growth.
Answer b. may contain antibiotic resistance genes.
11. Interferons are an important part of the host defense against viral infections. Their principal mode of action is that
a. they trigger the synthesis of one or more cellular proteins that inhibit viral replication.
b. they are present in the serum of healthy individuals and act as viral surveillance factors.
c. they coat viral particles and block their attachment to cells.
d. they protect the death of a viral-infected cell.
Answer a. they trigger the synthesis of one or more cellular proteins that inhibit viral replication.
12. The form of genetic exchange by which donor DNA is introduced into a recipient bacterial cell by a bacterial virus is
a. transformation.
b. conjugation.
c. transduction.
d. transfection.
e. vertical transfer.
Answer c. transduction.
13. Viruses usually initiate infection by first interacting with receptors on the surface of cells. Which of the following statements is most accurate about cellular receptors for viruses?
a. Cellular receptors for viruses have no known function.
b. All viruses within a given family use the same cellular receptor.
c. All cells in a susceptible host will express the viral receptor.
d. Successful infection of a cell by a virus may involve the interaction with more than one type of receptor.
Answer d. Successful infection of a cell by a virus may involve the interaction with more than one type of receptor.
14. What was Edward Jenner’s contribution to microbiology?
a. He discovered how to create a vaccine to trigger the body’s immune system to develop antibodies that fight microbes.
b. He proposed the germ theory.
c. He developed the compound microscope.
d. He developed the binomial nomenclature system.
Answer a. He discovered how to create a vaccine to trigger the body’s immune system to develop antibodies that fight microbes.
15. The production of RNA using DNA as a template is known as
a. transduction.
b. transformation.
c. transcription
d. translation.
Answer c. transcription
16. Humoral immunity involves the secretion of antibodies from
a. T cells.
b. macrophages.
c. neutrophils.
d. plasma cells.
Answer d. plasma cells
17. Which of the following describes the correct relationship between the major structures of a virus?
a. The envelope encloses the genome of the virus.
b. The capsid encloses the genome of the virus.
c. The capsid encloses the envelope of the virus.
d. The genome encloses the capsid of the virus.
Answer The capsid encloses the genome of the virus.
18. Immunity that results when a person is vaccinated against the 2009-H1N1 influenza is
a. active artificially acquired immunity.
b. passive naturally acquired immunity.
c. active naturally acquired immunity.
d. passive artificially acquired immunity.
Answer a. active artificially acquired immunity.
19. What are some benefits of our microbiome?
a. It can supply essential nutrients.
b. It can aid in preventing the colonization of pathogens.
c. It can ensure proper functioning of the host immune systems
d. It can aid in food digestion.
e. All of the above
Answer e. All of the above
14. Protein toxins that may interfere with host cell function or damage host cell membranes and are usually secreted by living bacteria are called
a. adhesion factors.
b. antibodies.
c. exotoxins
d. endotoxins.
Answer c. exotoxins
Part B. Short Answer (5 points each)
21. Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events and enzymes. Use the following DNA molecule to illustrate each stage.
3′ TACTAGCCACATCTACCGATC 5′ template strand
5′ ATGATCGGTGTAGATGGCTAG 3′ Coding (“inactive” strand)
22. Explain why the structure is or is not each of the following: a human T cell, a virus, a bacterial cell, a yeast cell.
23. Describe the difference between an emerging and a re-emerging disease and give a recent example of a viral or a bacterial infection of each and explain the reason for that classification.
24. Name the four types of acquired immunity and describe the mechanisms by which a person acquires the immunity (“how it is conferred”). In a table describe the following characteristics for each them: type of immunizing agent (antibodies or antigen), relative time for immunity to appear, relative time the immunity lasts, and the source of antibodies (for example, self or non-self) that act against a pathogen or other antigen
25. Which of the following three hypotheses is most likely?
26. Describe how the first and second lines of defense of your innate immune system can protect you from influenza-A infection.
27. List the stages of the viral life cycle and briefly describe the principal events in the stages of the life cycle of a virus in the Retroviridae family and explain what makes viruses in that family difficult to eliminate from the host. Name a virus in that family.
28. Explain why a secondary antibody response to an antigen may prevent a bacterial or viral disease when the primary adaptive immune response to that antigen did not protect the person from the disease. Be specific about the type of cells and products involved in the responses.
29. Read the following Science Daily article: NIH/National Institute of Allergy and Infectious Diseases. (2016, March 16). Experimental dengue vaccine protects all recipients in virus challenge study. ScienceDaily. Retrieved July 17, 2016 from www.sciencedaily.com/releases/2016/03/160316151106.htm. Write a brief summary (one paragraph) about the study that answers the following questions.
30. Genetic reassortment is a mechanism by which new influenza virus subtypes are produced. Using a virus with a three-segmented RNA genome as an example, describe and illustrate this process and include an example of genetic reassortment that resulted in a major change in the genome (antigenic shift ) creating a new influenza A subtype. Show all possible outcomes.
Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.
About Writedemy
We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.
How It Works
To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Are there Discounts?
All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.
