11 Jun Irvine BIO 60080 – Describe the differences between
Question
Bio 1
Study Problems #3 (21pts)
1) Describe the differences between somatic cell nuclear tranfer, and induced pluripotent
stem cells (2pts)
2) What is a "pluripotent" cell? In an embryo, where do the pluripotent cells come from?
(2pts)
3) How does PCR work and why is it useful? (2pts)
4) What is recombinant DNA? How do restriction enzymes involved in this process? (2pts)
5) Restriction enzymes are extensively used in molecular biology. The recognition site of
EcoRI enzyme is 5’ G^AATTC 3’ .You are given a DNA sequence below. (3pts)
5’ATGAATTCGATCTACCGGAATTCGTAA3’
3’TACTTAAGCATCATGGCCTTAAGCATT5’
a. If this DNA sequence was cut with EcoRI, how many DNA fragments would you
expect?
b. Write out the sequence of these double-stranded DNA fragments.
6) If one parent is type A and the other is type B, but all four blood types are represented
among the children, what were the genotypes of the parents? (2pts)
7) Describe the three types of biodiversity. (3pts)
8) What does the Cas9 enzyme do to DNA when it binds to the DNA? Explain. (2pts)
9) A population has only two alleles, A and a, for a particular gene. The allele frequency of
a is 35%. How many would have the genotypes of AA, Aa, and aa in a population of
500? (3pts)
Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.
About Writedemy
We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.
How It Works
To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Are there Discounts?
All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.
