27 Jun Microbiology Problem set
Question
Problem Set 4
1. Short regions of DNA sequence from four different organisms are shown below.
Organism
Organism
Organism
Organism
A
B
C
D
AGGTAAGTTACATTTGCAAGCTCTATTGACGCCC
AGGTAAGTTAGATTTGCAGGTCCTATTGACGCCC
AGGTAAGTTAGATTCGCAGGTCCTATTGACGCCC
AGCTAAGTTAGATTTGCAGGTCCTATTGACGCCC
Here are the same sequences aligned below for you to highlight their differences in sequence:
A) Strictly on the basis of these sequences (i.e. – extent of homology) briefly describe thephylogenetic relationship of these three organisms (i.e – which are the more closely ordistantly related)
B) Draw a rooted tree that illustrates your conclusions. (Use Fig. 17.17 in your text and thePhylogenetic Trees animation in the chapter 17 section of iLearn as guides for how toproceed with this part.)
C) Assume that the sequences above were obtained from 16s rRNA genes and that the percentsequence similarity you determined for these short sequences is the same as that for theentire 16s rRNA coding regions. Additionally, assume that: 1) further analysis reveals thatseveral orthologous genes have the same percent similarity that you saw in the SSU analysisand 2) total genomic DNA hybridization analysis reveals the percent similarity shown in thetable below. Using the working definition of a species described in section 17.5 of the class
textbook (3rd edition) and the guidelines in Figure 1 below, complete the table below.NOTE: the guidelines in the textbook are more up-to-date and take more factors intoconsideration than the guidelines in Figure 1, which are based solely on DNA hybridizationdata. Therefore, the guidelines in section 17.5 should take preference in cases where thetwo methods lead to alternative results.
Organisms A and D
% similarity
(DNA hybridization)
20
Organisms C and D
79
Organisms B and D
Same genus?
Same species?
71
D) Based on the data in part C above:
i) Which pair of organisms would you expect to have the highest degree of nucleotidesimilarity in their informational genes (as discussed in section 17.3)?
ii) Which pair has the highest degree of nucleotide similarity in their operational genes?
2. The purple phototrophic bacteria and the cyanobacteria can both generate energy byphotosynthesis but differ physiologically and ecologically in the way they do it. Which ofthese two photosynthetic organisms has remained more metabolically and ecologically similarto their last common ancestor? Explain the reasoning behind your answer. (4 points)
Problem Set 4
3. Eukaryotic cells are generally more highly compartmentalized than prokaryotic cells. Inaddition to the nucleus, eukaryotes contain a number of subcellular membrane-enclosedorganelles in the cytoplasm including, the endoplasmic reticulum, the Golgi, endosomes,hydrogenosomes, lysosomes, mitochondria, peroxisomes and, in photosynthetic organisms,chloroplasts. Additionally, eukaryotic cells also contain transport vesicles that move cargoamong particular organelles and secretory vesicles that deliver cargo to the cytoplasmicmembrane.
For each of the proteins below, list all of the subcellular organelles (indicated in bold typeabove) involved in its expression and targeting. For example, for the expression of acytoplasmic protein, the mRNA for the gene encoding it is transcribed in the nucleus andtransported to the cytoplasm where the protein is translated and released, so an appropriateanswer would be: nucleus and cytoplasm. The material in your textbook’s appendix A2.4should be helpful in answering these following questions.
A.
B.
C.
D.
a protein that is secreted from the cell
a lysosomal protein
a nuclear protein
the envelope glycoprotein (env) of HIV-1
In which compartments do the following processes occur?
E. oxidative phosphorylation
F. hydrolysis of macromolecules (such as proteins, fats and carbohydrates) that are taken upfrom the extracellular space by endocytosis or phagocytosis
G. photosynthesis
H. oxidation of pyruvate
I. transcription
J. glycosylation of proteins
K. sorting of proteins to appropriate organelles such as lysosomes
Tutorials for this Question
Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.
About Writedemy
We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.
How It Works
To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Are there Discounts?
All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.
