Chat with us, powered by LiveChat Ohio SCI 2100 – Including the start codon, how many amino | Writedemy

Ohio SCI 2100 – Including the start codon, how many amino

Ohio SCI 2100 – Including the start codon, how many amino

Question
DNA segment:3’end_CCAAGTACATATGGGTGAATGCGGTATGCAAATGATTGCAGGCGTGGAGATGCCCATGACGTAATCGCACTCAGT_5’end

1. Including the start codon, how many amino acids are in the primary structure of this protein?

2. What is the 11th amino acid in the protein you translated (including the start codon)?

3. Which amino acid is the most abundant in the protein you translated?

4. Would you expect this amino acid to form an alpha-helix?

5. If the 3rd nucleotide of the 16th amino acid was mistakenly transcribed as an adenine,would it impact:

the primary structure of this protein – yes/no

the secondary structure of this protein – yes/no

the tertiary structure of this protein – yes/no

6. A peptide bond forms between the two adjacent amino acids during translation. What two parts of the adjacent amino acids are involved with forming the peptide bond?

Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.

Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.

Do you need an answer to this or any other questions?

About Writedemy

We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.

How It Works

To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.

Are there Discounts?

All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.

Hire a tutor today CLICK HERE to make your first order