10 Jun The following sequence of bases is found in a section of bacterial
stion
Questions Related to Gene Sequences
The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.
AUGUUUGCUGGGGGACAUUCGUGGGCA
(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.
(b) Determine the sequence of amino acids coded for by this mRNA.
(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an example explain how is this possible.
(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.
(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?
i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.
In each case write down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.
Explain the possible effect on the polypeptide produced.
(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. Explain why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.
Tutorials for this Question
Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Ask A Question and we will direct you to our Order Page at WriteDemy. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.
About Writedemy
We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.
How It Works
To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Are there Discounts?
All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.