Why we can NOT consider viruses a living organism

26 Jun Why we can NOT consider viruses a living organism

Name:———————-

ID:————————–

Question I: Answer the following questions:

1. Why we can NOT consider viruses a living organism

2. What is the differences between prokaryotic and eukaryotic cells

3. What are the 4 major macromolecules

4. What are the differences between organelles classified under the endomembrane system AND semiautonomous organelles. Give examples of organelles under each group.

5. Compare the changes will take place in the cell structure after placing the following cells in hypertonic solution. Explain your answers.

a. Animal cell

b. Plant cell

6. What will happen if the cell lacks the flippase enzyme? Explain your answer.

7. What will happen if a plant cell lacks photosystem I and II. Explain your answer.

Question II: Gene Expression

Aliand Ahmadaretwograduatestudentsjoinedthe entomologylaboratory.Althoughboth of themstudythe sameinsectmodel-whichis(Drosophilamelanogaster)-;eachofthemfocusedonspecificstageofthe life cycleofthisinsect.For example,Aliisfocusingontheearly life knownas(larvastage),whereAhmadismore focusingonlaterstagewhenthat insect becomesa fullymatureadult insect.The twostudentswereaskedto analyzetheirinsectsamplesat differentlevels(anatomical,physiological,molecular….etc).WhenAliandAhmadcameto discussthere results;they foundinterestingsimilaritiesanddifferencesbetweentheir data.(8pts)

a. What isthe commonname forDrosophilamelanogaster?Andwhat are the 2 namesDrosophilamelanogasterreferringto? (2pts)

b. Ifwe ask Aliand Ahmadto sequenceDNAsamplesfrombothstages(larva and adultinsects),concludeiftheywillget identical,similarordifferent resultsandexplain why?(2pts)

c. Thewildtype ofDrosophilamelangosteradultnormallyhaswings, whilethe larvaofthe Drosophilamelangosterlacksthem.Basedon yourknowledge frombasicbiologycourseexplain why thishappening.(2pts)

d. Aliand Ahmaduseddifferenttechniquesto studythe genomeandproteome of the differentstagesofDrosophilamelanogaster.Guesswhattypesof radioactiveisotopestheyusedto studyboth genomeandproteome.Support youranswer.(2pts)

Question III: Cell respiration

III-A: Ahmad and Ali are two students affiliated to college of food sciences and agriculture. Ahmed is a great athlete who used to work out in the gym (5 times weekly) and also Ahmad joins swimming classes and foot ball matches in the weekends. Ali- on other hand- has sedentary normal daily activities. This includes sitting in classes listening to lectures, doing homeworks on the iPad, or watching movies during free-time. As a result, Ali started to gain weight and became unhappy with his body. Therefore, Ali decided to join gym to reduce his weight. Dr Asma asked you to study cell respiration of the muscles of both students right away after Ali’s first day joining the gym. Please predict and fill out following tables based on lecture (10pts)

Ahmad

Ali

Number of mitochondria/muscle (high or low)

oxygen consumption (depended or independent)

ATP molecules formed/ molecule of glucose (put the number please)

Pain and soreness of muscles (applies or does not apply)

Lactic acid accumulation in the muscles (applies or does not applies)

III-B: You were asked to prepare (1 molar) of glucose dissolved in water and a (1 molar) of pyruvate dissolved of water. You have also 3 groups of mice (A, B and C) in which you fasted them over night and then gave them the following:

a. Group A: 10 ml of H2O

b. Group B: 10 ml of (1M) glucose

c. Group C:10 ml of (1M) pyruvate (6pts)

10 ml of H2O

10 ml of (1M) glucose

I0 ml of (1M) Pyruvate

Amount of ATP molecules (None or low- medium or high)

Rate of ATP molecules formation (None- Slow- Fast)

Question IV: Macromolecules

Thisisa diagram of AT1receptoror(AT1R)(11pts)

.0/msohtmlclip1/01/clip_image004.gif”>

a. Underwhattype ofmacromoleculesisAT1Rclassified?Support youranswer fromthe diagram.(2pt)

b. Based on youranswerinpreviousquestion (3.a),specifythe followings:

i. Typeandnumberofthemonomers(2pt)

ii. Typeofthemajororganicbondconnectingthemonomersto formthe

AT1Rpolymer(1pt)

iii. ThenumberofH2O resultedduringthe formationofthe AT1R

polymerbyvia dehydrationprocess(1pt)

iv. HowmanytimesAT1Rpassthe plasmamembrane(1pt)

v. Explain whyAT1Rpolymercanpassthe plasmamembrane(1pt)

.0/msohtmlclip1/01/clip_image005.gif”>vi. What will happenifyouexchangeeachmonomerlocatedat the plasmamembraneregionwiththe monomer T ?Supportyour answer.(2pt)

vii. What impactwill the disulfidebonds(−S−) have on the AT1Rpolymer

structure?(1pt)

In the followingdiagramspecify-bydrawing-the followings(atbothreplicationforks)(10pts):

a. Helicase(1pt)

b. Topoisomerase(1pt)

c. Leadingstrandwiththe direction (2pts) d. Laggingstrandwiththe direction(2pts) e. Primer(s)(1pt)

f. Telomers(1pt)

g. Guesswhichofthe followingsequencesisprobablygoingto be the originof replication (thesequenceofonlyonestrandisshownhere)(1pt)

i. GCCCGGGATATGCGCCATGC

ii. GCATTTGTTAAATATATGCTAiii. GCATGCATGCATGCATTACGiv. GCUAUUUUUAAAGCUUACC

h. Support youranswerinpreviousquestion(1pt)

.0/msohtmlclip1/01/clip_image007.jpg”>